Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0003575 | |||
Gene | CHMP5 | Organism | Human |
Genome Locus | chr9:33271149-33278223:+ | Build | hg19 |
Disease | Atherosclerosis | ICD-10 | Atherosclerosis (I70) |
DBLink | Link to database | PMID | 28946214 |
Experimental Method | |||
Sample Type | Cell Lines | Comparison | Human umbilical vein endothelial cells (HUVECs) vs induced by oxLD |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CATCCGCTACCTCATCTCGT ReverseGTTGCTACCACCACTCCCATA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Li, CY, Ma, L, Yu, B (2017). Circular RNA hsa_circ_0003575 regulates oxLDL induced vascular endothelial cells proliferation and angiogenesis. Biomed. Pharmacother., 95:1514-1519. |